Skip to Content
Price List Default - EUR
  1. All Products
  2. Rabies virus PCR primer, Forward (5` CGATGAAGATCAAGATCATTGC 3`) - 200 nmol Synthesis scale (Lyophilized, HPLC Purified)
Rabies virus PCR primer, Forward (5` CGATGAAGATCAAGATCATTGC 3`) - 200 nmol Synthesis scale (Lyophilized, HPLC Purified)

Rabies virus PCR primer, Forward (5` CGATGAAGATCAAGATCATTGC 3`) - 200 nmol Synthesis scale (Lyophilized, HPLC Purified)

https://www.gentaur.com.pl/web/image/product.template/29140/image_1920?unique=8de7787
(0 review)

0.00 € 0.0 EUR 0.00 € Tax Excluded

info@gentaur.com

    This combination does not exist.

    Contact Us For Price

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Share