pGEX-4T-3 Plasmid - 2 ug

pGEX-4T-3 Plasmid Information

Alias: pgex4t3; pgex4t-3

TAC: promoter

Replicon: pBR322

Plasmid classification: Escherichia coli vector; pGEX series expression plasmid

Plasmid size: 4968 BP

Plasmid Tags: n-gst, n-thrombin

Prokaryotic resistance: amp

Clone strain: dh5a

Culture conditions: 37 degrees

Expression host: E.coli BL21 (DE3)

Culture conditions: 37 ℃, aerobic, lb

Induction method: IPTG or lactose and its analogues

5 'sequencing primer: pgex5: gggctggcaagccacgttgtggtg

3 'sequencing primer: pgex3: ccggaggtgcatgtcagagg

Note: GST affinity column can be used to purify recombinant protein

Plasmid host: Escherichia coli

Purpose of plasmid: protein expression

Fragment type: ORF

Fragment species: empty bodies

Prokaryotic resistance: amp

pGEX-4T-3 Plasmid Description

pGEX-4T-3 plasmid is a 4968 bp E.coli Expression Vector, which can be connected to the target gene through the enzyme cutting site at MCS, and tac promoter starts GST promoting labeling and target gene fusion expression.