Tous les produits

[0881-530037] ABRAXIS® Dioxins/Furans (TCDD) ELISA kit - 96 wells plate

ABRAXIS® Dioxins/Furans (TCDD) ELISA kit - 96 wells plate

[0245-1221333] AC-2110 II Perista® Pump

AC-2110 II Perista® Pump

[0245-1221201] AC-2120 Perista Pump, 230V Single channel only. Including 1 silicone tube each, 1-3 mm, 2-4 mm & 3-5 mm x 1 m

AC-2120 Perista Pump, 230V Single channel only. Including 1 silicone tube each, 1-3 mm, 2-4 mm & 3-5 mm x 1 m

[1137-CMO-1] ACTTACTTCTGACAACGATC (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

ACTTACTTCTGACAACGATC (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

[1137-CMO-3] ACTTACTTCTGACAACGATCGGAGGACCGA (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

ACTTACTTCTGACAACGATCGGAGGACCGA (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

[0820-S0010] AD494 (DE3) Escherichia coli Strains - 100ul

AD494 (DE3) Escherichia coli Strains - 100ul

[0133-G7010] ADCC Reporter Bioassay, V Variant, Core kit

ADCC Reporter Bioassay, V Variant, Core kit

[0133-G7018] ADCC Reporter Bioassay, V Variant, Core kit, 5X

ADCC Reporter Bioassay, V Variant, Core kit, 5X

[0408-NB300-30] ADVANTAGE Mounting Media (Permanent) for coverslipping stained biological specimen - 30 mL

ADVANTAGE Mounting Media (Permanent) for coverslipping stained biological specimen - 30 mL

[0245-2393010] AE-6401 1 mm Dual Mini Gel Casting kit - 1 kit

AE-6401 1 mm Dual Mini Gel Casting kit - 1 kit

Components:
Pair of glass plates (MAB-10,MB-00) x2, Smiling-less mini
comb x2, Seal gasket x2, Clip x4

[0893-ACC-106-01] AGL1 (pSoup) Chemically Competent Cell - 10 tubes (100μL/tube)

AGL1 (pSoup) Chemically Competent Cell - 10 tubes (100μL/tube)

[0820-STR3006] AGL1 Agrobacterium Strain - 100 uL

AGL1 Agrobacterium Strain - 100 uL

[0774-1083-06] AGL1 Chemically Competent Agrobacterium - 6 x 50 µL

AGL1 Chemically Competent Agrobacterium - 6 x 50 µL

[0774-1283-36] AGL1 ElectroCompetent Agrobacterium - 18x50ul

AGL1 ElectroCompetent Agrobacterium - 18x50ul

[0774-1283-12] AGL1 ElectroCompetent Agrobacterium - 6 x 50 µL

AGL1 ElectroCompetent Agrobacterium - 6 x 50 µL

[0820-S0063] AH109 Yeast Strains - 100 µL

AH109 Yeast Strains - 100 µL

[0992-HA601277] ALDH2 Recombinant Mouse Monoclonal Antibody [Clone: 7-D8-R] - 100 ug (Conc.: 1mg/ml)

ALDH2 Recombinant Mouse Monoclonal Antibody [Clone: 7-D8-R] - 100 ug (Conc.: 1mg/ml)

[BZ-505206] APC anti-mouse IL-12/IL-23 p40 (monomer, dimer, heterodimer) Antibody - 100 ug

APC anti-mouse IL-12/IL-23 p40 (monomer, dimer, heterodimer) Antibody - 100 ug

[0882-PH42106M5-100UG] APEX2 (NM_014481) Human Recombinant Protein - 100 ug

APEX2 (NM_014481) Human Recombinant Protein - 100 ug

[0016-0173] APF LB Broth Miller - 500 mL

APF LB Broth Miller - 500 mL

[1137-ASFMGF360-12LF(21bp)] ASFV PCR Primer (5`-CATACCCTTCCCCTAAAGCTG-3`) - 200 nmol (Lyophilized)

ASFV PCR Primer (5`-CATACCCTTCCCCTAAAGCTG-3`) - 200 nmol (Lyophilized)

Purification: RPC

[1137-ASFB-GUSR(21bp)] ASFV PCR Primer (5`-CGTAAGGGTAATGCGAGGTAC-3`) - 200 nmol (Lyophilized)

ASFV PCR Primer (5`-CGTAAGGGTAATGCGAGGTAC-3`) - 200 nmol (Lyophilized)

Purification: RPC

[1137-ASFMGF360-12LR(19bp)] ASFV PCR Primer (5`-CTACTGCTATGTCCTGGGC-3`) - 200 nmol (Lyophilized)

ASFV PCR Primer (5`-CTACTGCTATGTCCTGGGC-3`) - 200 nmol (Lyophilized)

Purification: RPC

[1137-ASFB-GUSF(22bp)] ASFV PCR Primer (5`-TCTACTTTACTGGCTTTGGTCG-3`) - 200 nmol (Lyophilized)

ASFV PCR Primer (5`-TCTACTTTACTGGCTTTGGTCG-3`) - 200 nmol (Lyophilized)

Purification: RPC

[1137-ASFMGF360Probe(24bp)] ASFV PCR Probe (5`-FAM-ACCCTCTTCGAAAACATCAGCCCC-BHQ1-3`) - 200 nmol (Lyophilized)

ASFV PCR Probe (5`-FAM-ACCCTCTTCGAAAACATCAGCCCC-BHQ1-3`) - 200 nmol (Lyophilized)

Purification: HPLC

[1137-ASFB-GUSProbe(26bp)] ASFV PCR Probe (5`-FAM-AGGATTCGATAACGTGCTGATGGTGC-BHQ1-3`) - 200 nmol (Lyophilized)

ASFV PCR Probe (5`-FAM-AGGATTCGATAACGTGCTGATGGTGC-BHQ1-3`) - 200 nmol (Lyophilized)

Purification: HPLC

[0774-1075-06] ATCC15834 Chemically Competent Agrobacterium Rhizobium rhizogenes - 6x 50 uL

ATCC15834 Chemically Competent Agrobacterium Rhizobium rhizogenes - 6x 50 uL

[0399-CSB-PA005808-100UL] ATP2A2 (SERCA2) Polyclonal Antibody - 100 uL

ATP2A2 (SERCA2) Polyclonal Antibody - 100 uL

[0544-MBS516659-0.05MG] AapCas12b Active recombinant protein - 0.05 mg

AapCas12b Active recombinant protein - 0.05 mg

[0875-WHM-J002] Absolute Mag™ DBCO Magnetic Particles, 0.97 μm - 1 mL (conc. 10 mg/mL)

Absolute Mag™ DBCO Magnetic Particles, 0.97 μm - 1 mL (conc. 10 mg/mL)

Accu-Edge® Low-Profile Hard Tissues (N35) - 50 blades dispenser

[0037-31007] AccuBlue® Broad Range dsDNA Quantitation Kit with DNA Standards - 1500 assays

AccuBlue® Broad Range dsDNA Quantitation Kit with DNA Standards - 1500 assays

[0037-31007-T] AccuBlue® Broad Range dsDNA Quantitation Kit with DNA Standards - 200 assays

AccuBlue® Broad Range dsDNA Quantitation Kit with DNA Standards - 200 assays

[0007-ACBP-150-10] AccuCount Blank Particles, 10^6/mL, 13.0-17.9um - 10mL

AccuCount Blank Particles, 10^6/mL, 13.0-17.9um - 10mL

[0007-ACBP-30-10] AccuCount Blank Particles, 10^6/mL, 3.0-3.9µm - 10 mL

AccuCount Blank Particles, 10^6/mL, 3.0-3.9µm - 10 mL

[0007-ACBP-50-10] AccuCount Blank, 10^6/mL, 5.0-5.9 µm - 10 mL

AccuCount Blank, 10^6/mL, 5.0-5.9 µm - 10 mL

[0007-ACBP-70-10] AccuCount Blank, 10^6/mL, 7.0-7.9µm, 10mL

AccuCount Blank, 10^6/mL, 7.0-7.9µm, 10mL

[0007-ACBP-100-10] AccuCount Blank, 10^6/mL, 8.0-12.9 µm - 10 mL

AccuCount Blank, 10^6/mL, 8.0-12.9 µm - 10 mL

[0007-ACFP-70-5] AccuCount Fluorescent Particles, 10^6/mL, 7.0-7.9µm - 5mL

AccuCount Fluorescent Particles, 10^6/mL, 7.0-7.9µm - 5mL

[0007-ACURFP-38-5] AccuCount Ultra Rainbow Fluorescent Particles, 10^6/mL, 3.8 (+/- 0.3)um - 5mL

AccuCount Ultra Rainbow Fluorescent Particles, 10^6/mL, 3.8 (+/- 0.3)um - 5mL

[0328-3144-18-CE] AccuDiag Human T3 (Triiodothyronine) ELISA kit (FDA, IVD) - 96-wells plate

AccuDiag Human T3 (Triiodothyronine) ELISA kit (FDA, IVD) - 96-wells plate

Ivd cortez

[0328-3144-16] AccuDiag Human T3 (Triiodothyronine) ELISA kit (RUO) - 96-wells plate

AccuDiag Human T3 (Triiodothyronine) ELISA kit (RUO) - 96-wells plate

[0328-3149-18-CE] AccuDiag Human T4 (Thyroxine) ELISA kit (FDA, IVD) - 96-wells plate

AccuDiag Human T4 (Thyroxine) ELISA kit (FDA, IVD) - 96-wells plate

[0328-3149-16] AccuDiag Human T4 (Thyroxine) ELISA kit (RUO) - 96-wells plate

AccuDiag Human T4 (Thyroxine) ELISA kit (RUO) - 96-wells plate

[0001-NAT1084] AccuGel 19:1 (30%) - 1L

AccuGel 19:1 (30%) - 1L

[0001-NAT1176] AccuGel 19:1 (30%) - 450ML

AccuGel 19:1 (30%) - 450ML

[0071-AN7050] Accudenz - 50 g

Accudenz - 50 g

[0071-AN7050-500g] Accudenz® A.G. Cell Separation Media - 500g

Accudenz® A.G. Cell Separation Media - 500g

[0862-GP6873-100MG] Acepromazine maleate - 100 mg

Acepromazine maleate - 100 mg

[0804-HY-B0823-100MG] Acetamiprid (Purity: >99.8%) - 100 mg

Acetamiprid (Purity: >99.8%) - 100 mg

[0323-WAK-AQA-250-50L] Acryl AquaClean 250 ml concentrate

Acryl AquaClean 250 ml concentrate

[1021-2705-1ML] ActiClean Etox - 1 mL prepacked column

ActiClean Etox - 1 mL prepacked column

[1021-2705-5ML] ActiClean Etox - 5 mL prepacked column

ActiClean Etox - 5 mL prepacked column

[0807-AB07-A] Actin protein (biotin), skeletal muscle - 5 x 20 µg

Actin protein (biotin), skeletal muscle - 5 x 20 µg

[0597-Oneq-H446-50D] Actinobacillus actinomycetemcomitans Real Time PCR kit - 50 reactions

Actinobacillus actinomycetemcomitans Real Time PCR kit - 50 reactions

[0763-E-AB-22115] Active CASP3 Monoclonal Antibody - 60 μL

Active CASP3 Monoclonal Antibody - 60 μL

[0338-APC007Hu01-200UG] Active Human Interleukin 34 (IL-34) - 200 ug

Active Human Interleukin 34 (IL-34) - 200 ug

[0338-APL917Hu02-200UG] Active Human Semaphorin 3A (SEMA3A) - 200 ug

Active Human Semaphorin 3A (SEMA3A) - 200 ug

[0338-APB120Mu01-200UG] Active Mouse Arginase (ARG) - 200 ug

Active Mouse Arginase (ARG) - 200 ug

[0338-APB120Mu01-50UG] Active Mouse Arginase (ARG) - 50 ug

Active Mouse Arginase (ARG) - 50 ug

[0338-APA049Mu01-200UG] Active Mouse Interferon Gamma (IFNg) - 200 ug

Active Mouse Interferon Gamma (IFNg) - 200 ug

[0338-APA049Mu01-50UG] Active Mouse Interferon Gamma (IFNg) - 50 ug

Active Mouse Interferon Gamma (IFNg) - 50 ug

[0338-APA063Mu61-200UG] Active Mouse Interleukin 17 (IL-17) - 200 ug

Active Mouse Interleukin 17 (IL-17) - 200 ug

[0338-APA063Mu61-50UG] Active Mouse Interleukin 17 (IL-17) - 50 ug

Active Mouse Interleukin 17 (IL-17) - 50 ug

[0338-APC032Mu61-200UG] Active Mouse Interleukin 22 (IL-22) - 200 ug

Active Mouse Interleukin 22 (IL-22) - 200 ug

[0338-APC032Mu61-50UG] Active Mouse Interleukin 22 (IL-22) - 50 ug

Active Mouse Interleukin 22 (IL-22) - 50 ug

[0338-APA551Hu01-1MG] Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 1 mg

Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 1 mg

[0338-APA551Hu01-10UG] Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 10 ug

Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 10 ug

[0338-APA551Hu01-200UG] Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 200 ug

Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 200 ug

[0338-APA551Hu01-50UG] Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 50 ug

Active Recombinant Human Fibroblast Growth Factor 2, Basic (FGF2) - 50 ug

[0338-APA297Hu01-1MG] Active Recombinant Human Ribonuclease A (RNase A) - 1 mg

Active Recombinant Human Ribonuclease A (RNase A) - 1 mg

[0338-APA297Hu01-10UG] Active Recombinant Human Ribonuclease A (RNase A) - 10 ug

Active Recombinant Human Ribonuclease A (RNase A) - 10 ug

[0338-APA297Hu01-200UG] Active Recombinant Human Ribonuclease A (RNase A) - 200 ug

Active Recombinant Human Ribonuclease A (RNase A) - 200 ug

[0338-APA297Hu01-5MG] Active Recombinant Human Ribonuclease A (RNase A) - 5 mg

Active Recombinant Human Ribonuclease A (RNase A) - 5 mg

[0338-APA297Hu01-50UG] Active Recombinant Human Ribonuclease A (RNase A) - 50 ug

Active Recombinant Human Ribonuclease A (RNase A) - 50 ug

[0245-3510147] Adapter for 96 wells plate for Kronos HT

Adapter for 96 wells plate for Kronos HT

[0862-GK3475-5G] Adenosine 5''-diphosphate sodium salt [CAS# 20398-34-9] - 5 grams

Adenosine 5''-diphosphate sodium salt [CAS# 20398-34-9] - 5 grams

[0002-KZMC035] Adenovirus Rapid Test Control Pack - 2 X 1.5mL

Adenovirus Rapid Test Control Pack - 2 X 1.5mL

[0622-NBP2-22450-0.025MG] Adiponectin/Acrp30 Monoclonal Antibody [Clone: 19F1] - 0.025 mg

Adiponectin/Acrp30 Monoclonal Antibody [Clone: 19F1] - 0.025 mg

[0622-NBP2-22450] Adiponectin/Acrp30 Monoclonal Antibody [Clone: 19F1] - 100 ug

Adiponectin/Acrp30 Monoclonal Antibody [Clone: 19F1] - 100 ug

[0239-31060] Adult Rabbit Complement Unadsorbed, 100 ml

Adult Rabbit Complement Unadsorbed, 100 ml

[AFG-BTL-034357-01] AffiELISA® Fish Heat Shock Protein 70 (HSP-70) ELISA Kit - 96-wells plate

AffiELISA® Fish Heat Shock Protein 70 (HSP-70) ELISA Kit - 96-wells plate

[0100-CNX5-65ALY-Z] Affinity Purified Chicken anti-CHO Annexin 5 Antibody, 0.1 mg

Affinity Purified Chicken anti-CHO Annexin 5 Antibody, 0.1 mg

[0173-1116785] Afinion™ CRP Control kit - 1 kit

Afinion™ CRP Control kit - 1 kit

[0173-1116787] Afinion™ CRP rapid test kit - 15 tests/kit

Afinion™ CRP rapid test kit - 15 tests/kit

[0767-LSY-20113-DUAL-STRIP-10T] African Swine Fever Virus (ASFV) Antigen Rapid Test card kit (two strips, P32 and P72 antigens) - 10 tests/kit

African Swine Fever Virus (ASFV) Antigen Rapid Test card kit (two strips, P32 and P72 antigens) - 10 tests/kit

[0767-LSY-20113-10T] African Swine Fever Virus (ASFV) Antigen Rapid Test card kit - 10 tests/kit

African Swine Fever Virus (ASFV) Antigen Rapid Test card kit - 10 tests/kit

[0767-LSY-20113] African Swine Fever Virus (ASFV) Antigen Rapid Test card kit - 40 tests/kit

African Swine Fever Virus (ASFV) Antigen Rapid Test card kit - 40 tests/kit

[0964-ZP01340H] African Swine Fever Virus (ASFV) RT-PCR Kit - 50 reactions

African Swine Fever Virus (ASFV) RT-PCR Kit - 50 reactions

[0964-ZP01340-50T] African Swine Fever Virus (ASFV) Real-time PCR Kit - 50 reactions

African Swine Fever Virus (ASFV) Real-time PCR Kit - 50 reactions

[0597-PCR-V121-48D] African swine fever virus (ASFV) End-Point PCR kit - 48 reactions

African swine fever virus (ASFV) End-Point PCR kit - 48 reactions

DNA extraction kit is not included.

[0597-PCR-V121-96D] African swine fever virus (ASFV) End-Point PCR kit - 96 reactions

African swine fever virus (ASFV) End-Point PCR kit - 96 reactions

DNA extraction kit is not included.

[0031-G243-100G] Agar D, Purified Agar - 100 grams

Agar D, Purified Agar - 100 grams

[0232-A296-100G] Agar, Micropropagation Cell culture grade, Gelling Strength >700 g/cm2 - 100 g

Agar, Micropropagation Cell culture grade, Gelling Strength >700 g/cm2 - 100 g

[0645-604-005] Agarose (Molecular Biology Grade) - 500 g

Agarose (Molecular Biology Grade) - 500 g

[1465-EG20910M] Agarose (Molecular Biology Grade) - 500 grams

Agarose (Molecular Biology Grade) - 500 grams

[0037-41028-500G] Agarose LE, Ultra-Pure Molecular Biology Grade - 500 g

Agarose LE, Ultra-Pure Molecular Biology Grade - 500 g

[MB755-0500] Agarose Powder (Molecular Biology Grade) - 500 grams

Agarose Powder (Molecular Biology Grade) - 500 grams

[0774-1091-12] Agrobacterium Chemically Competent Combo Pack (GV3101, AGL1, EHA105 and LBA4404 + pCAMBIA1391z control) - 12x50µL (3x50µL of each strain)

Agrobacterium Chemically Competent Combo Pack (GV3101, AGL1, EHA105 and LBA4404 + pCAMBIA1391z control) - 12x50µL (3x50µL of each strain)

[0763-E-BC-K235-M-96T] Alanine Aminotransferase (ALT/GPT) Activity Assay Kit - 96 tests (42 samples)

Alanine Aminotransferase (ALT/GPT) Activity Assay Kit - 96 tests (42 samples)

1
2
3
4
…
34