p3xFLAG-CMV-14 plasmid - 2 ug

(0 beoordeling)

369,00 € 369.0 EUR 369,00 € Exclusief btw

369,00 € Exclusief btw

Not Available For Sale

    Deze combinatie bestaat niet.

    Terms and Conditions
    30-dagen geld terug garantie
    Verzending: 2-3 werkdagen

    p3xFLAG-CMV-14 vector is a 6.3 KB carrier derived from the pCMV5 vector, which is used for transient expression in mammalian cells or the stable expression of C terminal with 3xFlag tag fusion protein. Three adjacent Flag epitopes (Asp-Tyr-Lys-Xaa-Xaa-Asp) were encoded by the downstream fragment of the vector. This makes it possible to detect protein expression using M2 Flag antibody.

    Promoter: CMV

    Replicon: pUC

    Terminator: SV40 poly (a) signal, hGH poly (a) signal

    Plasmid classification: mammalian cells, protein overexpression vector

    Plasmid size: 6310bp

    Prokaryotic resistance: Amp

    Eukaryotic resistance: G418

    Clone strain: DH5a

    Culture conditions: 37℃

    Expression host: Mammalian cells

    Induction mode: transient expression without induction

    5 'sequencing primer: cmv-f: cgcaaaatgggcgtgtgtgggtgggtg

    3 'sequencing primer: hgh-pa-r: ccagttgtcccaataga

    Plasmid host: mammalian cells

    Purpose of plasmid: protein expression

    Fragment type: ORF

    Fragment species: empty bodies

    Prokaryotic resistance: Amp

    Eukaryotic resistance: G418


    1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct

           61 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg

          121 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa

          181 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta

          241 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc

          301 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg

          361 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc

          421 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat

          481 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc

          541 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga

          601 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg

          661 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac

          721 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt

          781 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc

          841 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc

          901 tcgtttagtg aaccgtcaga attaagcttg cggccgcgaa ttcatcgata gatctgatat

          961 cggtaccagt cgactctaga ggatcccggg ctgactacaa agaccatgac ggtgattata

         1021 aagatcatga catcgactac aaggatgacg atgacaagta gtgatcccgg gtggcatccc

         1081 tgtgacccct ccccagtgcc tctcctggcc ctggaagttg ccactccagt gcccaccagc

         1141 cttgtcctaa taaaattaag ttgcatcatt ttgtctgact aggtgtcctt ctataatatt

         1201 atggggtgga ggggggtggt atggagcaag gggcaagttg ggaagacaac ctgtagggcc

         1261 tgcggggtct attgggaacc aagctggagt gcagtggcac aatcttggct cactgcaatc

         1321 tccgcctcct gggttcaagc gattctcctg cctcagcctc ccgagttgtt gggattccag

         1381 gcatgcatga ccaggctcag ctaatttttg tttttttggt agagacgggg tttcaccata

         1441 ttggccaggc tggtctccaa ctcctaatct caggtgatct acccaccttg gcctcccaaa

         1501 ttgctgggat tacaggcgtg aaccactgct cccttccctg tccttctgat tttaaaataa

         1561 ctataccagc aggaggacgt ccagacacag cataggctac ctggccatgc ccaaccggtg

         1621 ggacatttga gttgcttgct tggcactgtc ctctcatgcg ttgggtccac tcagtagatg

         1681 cctgttgaat tgggtacgcg gccagcttgg ctgtggaatg tgtgtcagtt agggtgtgga

         1741 aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca

         1801 accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc

         1861 aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc

         1921 agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag

         1981 gccgcctcgg cctctgagct attccagaag tagtgaggag gcttttttgg aggaattgat

         2041 cagcttggga tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg

         2101 attgcacgca ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca

         2161 acagacaatc ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt

         2221 tctttttgtc aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg

         2281 gctatcgtgg ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga

         2341 agcgggaagg gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca

         2401 ccttgctcct gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct

         2461 tgatccggct acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac

         2521 tcggatggaa gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc

         2581 gccagccgaa ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt

         2641 gacccatggc gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt

         2701 catcgactgt ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg

         2761 tgatattgct gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat

         2821 cgccgctccc gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc

         2881 gggactctgg ggttcgaaat gaccgaccaa gcgacgccca acctgccatc acgagatttc

         2941 gattccaccg ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc

         3001 tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccaccc cgggctcgat

         3061 cccctcgcga gttggttcag ctgctgcctg aggctggacg acctcgcgga gttctaccgg

         3121 cagtgcaaat ccgtcggcat ccaggaaacc agcagcggct atccgcgcat ccatgccccc

         3181 gaactgcagg agtggggagg cacgatggcc gctttggtcg acccggacgg gacgctcctg

         3241 cgcctgatac agaacgaatt gcttgcaggc atctcatgag tgtgtcttcc cgttttccgc

         3301 ctgaggtcac tgcgtggatg gagcgctggc gcctgctgcg cgacggcgag ctgctcacca

         3361 cccactcgcc aagctggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc

         3421 gccgatcata atcagccata ccacatttgt agaggtttta cttgctttaa aaaacctccc

         3481 acacctcccc ctgaacctga aacataaaat gaatgcaatt gttgttgtta acttgtttat

         3541 tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt

         3601 tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg

         3661 gatcaattcc ctatagtgag tcgtattaaa ttcgtaatca tgtcatagct gtttcctgtg

         3721 tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa

         3781 gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct

         3841 ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga

         3901 ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc

         3961 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa

         4021 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt

         4081 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa

         4141 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt

         4201 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg

         4261 tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc

         4321 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc

         4381 gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta

         4441 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct

         4501 acagagttct tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc

         4561 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa

         4621 caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa

         4681 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa

         4741 aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt

         4801 ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac

         4861 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc

         4921 atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc

         4981 cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata

         5041 aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc

         5101 cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc

         5161 aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca

         5221 ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa

         5281 gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca

         5341 ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt

         5401 tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt

         5461 tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg

         5521 ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga

         5581 tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc

         5641 agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg

         5701 acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag

         5761 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg

         5821 gttccgcgca catttccccg aaaagtgcca cctgacgcgc cctgtagcgg cgcattaagc

         5881 gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc

         5941 gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct

         6001 ctaaatcggg ggctcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa

         6061 aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc

         6121 cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca

         6181 ctcaacccta tctcggtcta ttcttttgat ttataaggga ttttgccgat ttcggcctat

         6241 tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attttaacaa aatattaacg

         6301 cttacaattt