(0 beoordeling)

444,00 € 444.0 EUR 444,00 € Exclusief btw

444,00 € Exclusief btw

Not Available For Sale

    Deze combinatie bestaat niet.

    Terms and Conditions
    30-dagen geld terug garantie
    Verzending: 2-3 werkdagen


    Catalog No. PVT11079
    Packing 2ug


    pCDH-MSCV-MCS-EF1-CopGFP-T2A-Puro Information

    Plasmid type: lentivirus expression vector: cDNA expression vector: Double promoter vector

    Cloning methods: polyclonal sites, restriction endonuclease

    Promoter: MSCV

    Carrier size:-

    MSCV: ggggtacagtgcaggggaaagaat (Note: this primer is

    5 'sequencing primer and sequence:

    The MSCV primer specially used by SBI company is completely different from the general-purpose MSCV primer MSCV: ccttgaacctcctcgttcgacc owned by sequencing company)

    3 'sequencing primer and sequence: pcdh1-r: ccttctctagcacccgttcaat

    Carrier label: None

    Carrier resistance: ampicillin

    Screening markers: puromycin, GFP

    Clone strain: E. coli cells (RecA -) recommendation: stbl2, omnimax 2 T1R

    Host cell (line): hematopoietic ten cells, embryonic ten cells

    Pcdh-mscv-mcs-ef1-copgfp-t2a-puro lentivirus expression vector is an HIV based lentivirus vector; For cDNA expression and cloning; Efficiently transfect cells and establish stable cell lines:

    Note: the MSCV promoter drives the high level expression of the gene on the day, and the ef1a promoter drives the medium level expression of the reporter gene; Including T2a element.

    Stability: stable expression

    Button shaped / induced: constitutive

    Viral / non viral: lentivirus (HIV)


    pCDH-MSCV-MCS-EF1-CopGFP-T2A-Puro Background

    This manual provides details and information necessary to generate expression constructs ofyour gene of interest in the pCDH cDNA Cloning and Expression Lentivectors. Specifically, itprovides critical instructions on amplification and cloning cDNA into the pCDH vectors, andverification of the final expression constructs.This manual does not include information onpackaging the pCDH expression constructs into pseudotyped viral particles or transducingyour target cells of choice with these particles.This information is available in the user
    manual LentivectorExpression Systems:Guide to Packaging and Transduction of Target Cells which is available on the SBl website.Before using the reagents and material supplied withthis system, please read the entire manual.

    Characteristics of pCDH lentivirus vector based on HIV-1:

    Multiple Cloning Site(MCS)—for cloning the gene of interest in the MCs locateddownstream of the CMv promoter.
    wPRE element—enhances stability and translation of the CMv-driven transcripts.
    sV4o polyadenylation signal—enables efficient termination of transcription and processingof recombinant transcripts.
    Hybrid RSVI/,LTR promoter—provides a high level of expression of the full-length viraltranscript in producer 293 cells.
    Genetic elements(cPPT, gag, env,LTRs)—necessary for packaging, transducing, and stablyintegrating the vira expression construct into genomic DNA.
    sV4o origin—for stable propagation of the pCDH plasmid in mammalian cells.puc origin—for high copy replication and maintenance of the plasmid in E.coli cells.Ampicillin resistance gene—for selection in E.coli cells.

    Advantages of pcdh lentivirus expression vector:

    Lentiviral expression vectors are the most effective vehicles for the delivery and expressionof a gene of interest to almost any mammalian cell—including non-dividing cells and modelorganisms(C.A. Machida, 2oo3; M.Federico, zoo3; W.C.Heiser, 2oo4). As with standardplasmid vectors, it is possible to introduce lentivector expression constructs in plasmid forminto the cells with low-to-medium efficiency using conventionaltransfection protocols.However, by packaging the lentivector construct into viral particles, you can obtain highlyefficient transduction of expression constructs—even with the most difficult to transfect cells,such as primary, stem, and differentiated cells.The expression construct transduced in targetcells is integrated into genomic DNA and provides stable, long-term expression of the targetgene.

    Packaging vector and cell line of pcdh lentivirus vector:
    The expression lentivector contains the genetic elements responsible for packaging,transduction, stable integration of the viral expression construct into genomic DNA, andexpression of the target gene sequence.The packaging vector provides all the proteinsessential for transcription and packaging of an RNA copy of the expression construct intorecombinant viral paticles.To produce a high titer of viral particles, expression and
    packaging vectors are transiently co-transfected into producer mammalian cells (e.g.,HEK293 cells).For a detailed description of BI's Lentivector expression system,please refer tothe Lentivector Expression System user manual.


    pCDH-MSCV-MCS-EF1-CopGFP-T2A-Puro Sequence



    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.