Molecular Biology

[1035-EBT-GG3870] 1% Agarose TAE w/GelGreen, Portrait Gel, 10 well, 1.0mm comb, 5 packs of 2 gels/box

1% Agarose TAE w/GelGreen, Portrait Gel, 10 well, 1.0mm comb, 5 packs of 2 gels/box

[0439-320] 5x OmniTaq PCR Kit - 500 x 25 ul rxns

5x OmniTaq PCR Kit - 500 x 25 ul rxns

[0964-ZP01340-50T] African Swine Fever Virus (ASFV) Real-time PCR Kit - 50 reactions

African Swine Fever Virus (ASFV) Real-time PCR Kit - 50 reactions

[0597-PCR-V121-48D] African swine fever virus (ASFV) End-Point PCR kit - 48 reactions

African swine fever virus (ASFV) End-Point PCR kit - 48 reactions

DNA extraction kit is not included.

[0597-PCR-V121-96D] African swine fever virus (ASFV) End-Point PCR kit - 96 reactions

African swine fever virus (ASFV) End-Point PCR kit - 96 reactions

DNA extraction kit is not included.

[0743-PDPS-AR148-50T] Avian Leukosis Virus (ALV, subgroups A, B, C, D, E) Real Time RT-PCR Kit - 50 reactions

Avian Leukosis Virus (ALV, subgroups A, B, C, D, E) Real Time RT-PCR Kit - 50 reactions

[1137-AMA-1_Fw] Babesia bigemina PCR primer (forward) - 100 nmol (Lyophilized)

Babesia bigemina PCR primer (forward) - 100 nmol (Lyophilized)

Sequence:
TACTGTGACGAGGACGGATC

[1137-AMA-1_Rev] Babesia bigemina PCR primer (reverse) - 100 nmol (Lyophilized)

Babesia bigemina PCR primer (reverse) - 100 nmol (Lyophilized)

Sequence:
CCTCAAAAGCAGATTCGGAGT

[1137-RAP-1_1st_Fwd] Babesia bovis Nested PCR primer (1st forward) - 100 nmol (Lyophilized)

Babesia bovis Nested PCR primer (1st forward) - 100 nmol (Lyophilized)

Sequence:
CACGAGCAAGGAACTACCGATGTTGA

[1137-RAP-1_1st_Rev] Babesia bovis Nested PCR primer (1st reverse) - 100 nmol (Lyophilized)

Babesia bovis Nested PCR primer (1st reverse) - 100 nmol (Lyophilized)

Sequence:
CCAAGGACCTTCAACGTACGAGGTCA

[1137-RAP-1_2nd_Fwd] Babesia bovis Nested PCR primer (2nd forward) - 100 nmol (Lyophilized)

Babesia bovis Nested PCR primer (2nd forward) - 100 nmol (Lyophilized)

Sequence:
TCAACAAGGTACTCTATATGGCTACC

[1137-RAP-1_2nd_Rev] Babesia bovis Nested PCR primer (2nd reverse) - 100 nmol (Lyophilized)

Babesia bovis Nested PCR primer (2nd reverse) - 100 nmol (Lyophilized)

Sequence:
CTACCGAGCAGAACCTTCTTCACCAT

[0597-Oneq-V143-100D] Babesia equi One-Step PCR - 100 Reactions

Babesia equi One-Step PCR - 100 Reactions

[0597-Oneq-V143-150D] Babesia equi One-Step PCR - 150 Reactions

Babesia equi One-Step PCR - 150 Reactions

[0597-Oneq-V143-50D] Babesia equi One-Step PCR - 50 Reactions

Babesia equi One-Step PCR - 50 Reactions

[0171-G891] BlasTaq™ 2X qPCR MasterMix - 500 Reactions (4 x 1.25 mL)

BlasTaq™ 2X qPCR MasterMix - 500 Reactions (4 x 1.25 mL)

[0597-RTq-V212-150D] Brucella abortus S19RB51 Real Time PCR kit - 150 reactions

Brucella abortus S19RB51 Real Time PCR kit - 150 reactions

[1137-C2700F] Caseous lymphadenitis PCR primer (forward) - 100 nmol (Lyophilized)

Caseous lymphadenitis PCR primer (forward) - 100 nmol (Lyophilized)

Sequence:
CGTATGAACATCGGCCAGGT

[1137-C3130R] Caseous lymphadenitis PCR primer (reverse) - 100 nmol (Lyophilized)

Caseous lymphadenitis PCR primer (reverse) - 100 nmol (Lyophilized)

Sequence:
TCCATTTCGCCGAAGCGCTG

[0881-5422220610] DNAnimal Ident Beef IPC (LR/HR) PCR kit

DNAnimal Ident Beef IPC (LR/HR) PCR kit

[0388-302-C] DirectPCR Lysis Reagent (Cell) - 100mL

DirectPCR Lysis Reagent (Cell) - 100mL

[0388-301-C] DirectPCR Lysis Reagent (Cell) - 50mL

DirectPCR Lysis Reagent (Cell) - 50mL

[0388-402-E] DirectPCR Lysis Reagent (Ear) - 50 mL

DirectPCR Lysis Reagent (Ear) - 50 mL

[0388-401-E] DirectPCR Lysis Reagent (Mouse Ear) - 25 mL

DirectPCR Lysis Reagent (Mouse Ear) - 25 mL

[0388-102-T] DirectPCR Lysis Reagent (Mouse Tail) - 100ml

DirectPCR Lysis Reagent (Mouse Tail) - 100ml

[0388-101-T] DirectPCR Lysis Reagent (Mouse Tail) - 50 mL

DirectPCR Lysis Reagent (Mouse Tail) - 50 mL

[0062-DD-704] Dog Bone Marrow cDNA - 30 reactions (30 PCR amplifications)

Dog Bone Marrow cDNA - 30 reactions (30 PCR amplifications)

[0322-EXOU100A-1] Exo-Urine EV Isolation Kit - 2 x 5 reactions

Exo-Urine EV Isolation Kit - 2 x 5 reactions

[0322-EXOMS120A-8] ExoMS Total Protein Capture Kit - 8 Reactions

ExoMS Total Protein Capture Kit - 8 Reactions

[0322-EQ808A-1] ExoQuick Exosome RNA Column Purification kit - 20 preps

ExoQuick Exosome RNA Column Purification kit - 20 preps

[0620-103-102] Expin PCR SV mini - 200p

Expin PCR SV mini - 200p

[0037-31044-T] Forget-Me-Not™ Universal Probe qPCR Master Mix - 1 mL (100 reactions)

Forget-Me-Not™ Universal Probe qPCR Master Mix - 1 mL (100 reactions)

[0037-31044-1] Forget-Me-Not™ Universal Probe qPCR Master Mix - 5x 1 mL (500 reactions)

Forget-Me-Not™ Universal Probe qPCR Master Mix - 5x 1 mL (500 reactions)

[0597-Oneq-A341-50D] Geotrichum candidum One-Step real time PCR kit - 50 rnx

Geotrichum candidum One-Step real time PCR kit - 50 rnx

[0441- V3-100/2FRT] Hepatitis D Virus (HDV) Real Time PCR Kit (Quantitative) - 100 reactions

Hepatitis D Virus (HDV) Real Time PCR Kit (Quantitative) - 100 reactions

[0743-ND-01] Human APOE genotypes (ε2/ε3/ε4) Real Time PCR Kit - 24 Reactions

Human APOE genotypes (ε2/ε3/ε4) Real Time PCR Kit - 24 Reactions

[0062-HD-704] Human Bone Marrow cDNA (primed with oligo dT primers) - 30 reactions (30 PCR amplifications)

Human Bone Marrow cDNA (primed with oligo dT primers) - 30 reactions (30 PCR amplifications)

[0062-HD-704-HR] Human Bone Marrow cDNA (primed with random hexamer primers) - 30 reactions (30 PCR amplifications)

Human Bone Marrow cDNA (primed with random hexamer primers) - 30 reactions (30 PCR amplifications)

[0597-Oneq-V381-100R] Lactate dehydrogenase-elevating virus RT PCR & One Step qPCR, 100 rxn

Lactate dehydrogenase-elevating virus RT PCR & One Step qPCR, 100 rxn

[0597-RTq-H653-50D] MDR Mycobacterium tuberculosis (Ethambutol) Real Time qPCR kit - 50 reactions

MDR Mycobacterium tuberculosis (Ethambutol) Real Time qPCR kit - 50 reactions

[0356-P-1028-200] Methylamp MS-qPCR Fast Kit - 200 Reactions

Methylamp MS-qPCR Fast Kit - 200 Reactions

[0062-KD-703] Monkey (Cynomolgus) Lymph nodes cDNA - 30 reactions (30 PCR amplifications)

Monkey (Cynomolgus) Lymph nodes cDNA - 30 reactions (30 PCR amplifications)

[0062-KD-408] Monkey (Cynomolgus) Prostate cDNA - 30 reactions (30 PCR amplifications)

Monkey (Cynomolgus) Prostate cDNA - 30 reactions (30 PCR amplifications)

[0597-RTq-V261-150R] Nervous necrosis virus Real Time qPCR kit - 150 reactions

Nervous necrosis virus Real Time qPCR kit - 150 reactions

[0441-R-27/P-48FRT] Oncogenetics BRCA Panel Real-TM

Oncogenetics BRCA Panel Real-TM

[0888-MS1000-PCR1] Optically clear sealing film for qPCR (Peelable) - 100 Films/Unit

Optically clear sealing film for qPCR (Peelable) - 100 Films/Unit

[0888-MS1000-PCR3] Optically clear sealing film for qPCR (Pierceable) - 100 Films/Unit

Optically clear sealing film for qPCR (Pierceable) - 100 Films/Unit

[0888-MS1000-PCR2] Optically clear sealing film for qPCR (Strong bond) - 100 Films/Unit

Optically clear sealing film for qPCR (Strong bond) - 100 Films/Unit

[0855-EQ008-100UL] Pfu DNA Polymerase -

Pfu DNA Polymerase -

[0597-RTq-V255-150D] Red sea bream iridoviral disease Real Time qPCR kit - 150 reactions

Red sea bream iridoviral disease Real Time qPCR kit - 150 reactions

[0597-RTq-V246-150D] Renibacterium salmoninarum (Bacterial kidney disease, BKD) Real Time qPCR kit - 150 rnx.

Renibacterium salmoninarum (Bacterial kidney disease, BKD) Real Time qPCR kit - 150 rnx.

[0441-V435-100FRT] SARS-CoV-2 Real-Time PCR kit - 96 tests

SARS-CoV-2 Real-Time PCR kit - 96 tests

[0322-RA806TC-1] SeraMir Exosome RNA Purification kit (10mL ExoQuick-TC and 10 exoRNA columns) - 10 preps

SeraMir Exosome RNA Purification kit (10mL ExoQuick-TC and 10 exoRNA columns) - 10 preps

[0597-RTq-V284-150D] Spawner-isolated mortality virus Real time PCR kit - 150 reactions

Spawner-isolated mortality virus Real time PCR kit - 150 reactions

[0597-Oneq-V266-150R] Spring viraemia of carp virus Real Time qPCR kit - 150 reactions

Spring viraemia of carp virus Real Time qPCR kit - 150 reactions

[0743-PDPS-AR114] Tick-borne Encephalitis Virus (TBEV) Real Time RT-PCR Kit - 50 rnx

Tick-borne Encephalitis Virus (TBEV) Real Time RT-PCR Kit - 50 rnx

[0900-TBS42003] Tribo™ Porcine QPCR, 100 reactions

Tribo™ Porcine QPCR, 100 reactions

[0925-633010001] Truelab® Quattro Real Time Quantitative micro PCR Analyzer - 1 unit

Truelab® Quattro Real Time Quantitative micro PCR Analyzer - 1 unit

[0925-601130020] Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 20 tests

Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 20 tests

[0925-601130025] Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 25 tests

Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 25 tests

[0925-601130050] Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 50 tests

Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 50 tests

[1137-RoTat_1.2_Fw] Trypanosoma evansi PCR primer (forward) - 100 nmol (Lyophilized)

Trypanosoma evansi PCR primer (forward) - 100 nmol (Lyophilized)

Sequence:
GCGGGGTGTTTAAAGCAATA

[1137-RoTat_1.2_Rev] Trypanosoma evansi PCR primer (reverse) - 100 nmol (Lyophilized)

Trypanosoma evansi PCR primer (reverse) - 100 nmol (Lyophilized)

Sequence:
ATTAGTGCTGCGTGTGTTCG

[0322-XCF200A-1] XCF Exosomal DNA Isolation Kit - 20 rxn

XCF Exosomal DNA Isolation Kit - 20 rxn

[0171-LV900] qPCR Lentivirus Titration kit - 100 reactions

qPCR Lentivirus Titration kit - 100 reactions