Overslaan naar inhoud
  1. Producten
  2. Molecular Biology

Molecular Biology

Price List Default - EUR
Sorteren op: Naam (A-Z)

Molecular Biology

5x OmniTaq PCR Kit - 500 x 25 ul rxns
info@gentaur.com 0.0 EUR
African Swine Fever Virus (ASFV) Real-time PCR Kit - 50 reactions
info@gentaur.com 0.0 EUR
African swine fever virus (ASFV) End-Point PCR kit - 48 reactions
DNA extraction kit is not included.
info@gentaur.com 0.0 EUR
African swine fever virus (ASFV) End-Point PCR kit - 96 reactions
DNA extraction kit is not included.
info@gentaur.com 0.0 EUR
Avian Leukosis Virus (ALV, subgroups A, B, C, D, E) Real Time RT-PCR Kit - 50 reactions
info@gentaur.com 0.0 EUR
Babesia bigemina PCR primer (forward) - 100 nmol (Lyophilized)
Sequence:
TACTGTGACGAGGACGGATC
info@gentaur.com 0.0 EUR
Babesia bigemina PCR primer (reverse) - 100 nmol (Lyophilized)
Sequence:
CCTCAAAAGCAGATTCGGAGT
info@gentaur.com 0.0 EUR
Babesia bovis Nested PCR primer (1st forward) - 100 nmol (Lyophilized)
Sequence:
CACGAGCAAGGAACTACCGATGTTGA
info@gentaur.com 0.0 EUR
Babesia bovis Nested PCR primer (1st reverse) - 100 nmol (Lyophilized)
Sequence:
CCAAGGACCTTCAACGTACGAGGTCA
info@gentaur.com 0.0 EUR
Babesia bovis Nested PCR primer (2nd forward) - 100 nmol (Lyophilized)
Sequence:
TCAACAAGGTACTCTATATGGCTACC
info@gentaur.com 0.0 EUR
Babesia bovis Nested PCR primer (2nd reverse) - 100 nmol (Lyophilized)
Sequence:
CTACCGAGCAGAACCTTCTTCACCAT
info@gentaur.com 0.0 EUR
Babesia equi One-Step PCR - 100 Reactions
info@gentaur.com 0.0 EUR
Babesia equi One-Step PCR - 150 Reactions
info@gentaur.com 0.0 EUR
Babesia equi One-Step PCR - 50 Reactions
info@gentaur.com 0.0 EUR
BlasTaq™ 2X qPCR MasterMix - 500 rxn (4 x 1.25 ml)
info@gentaur.com 0.0 EUR
Brucella abortus S19RB51 Real Time PCR kit - 150 reactions
info@gentaur.com 0.0 EUR
Caseous lymphadenitis PCR primer (forward) - 100 nmol (Lyophilized)
Sequence:
CGTATGAACATCGGCCAGGT
info@gentaur.com 0.0 EUR
Caseous lymphadenitis PCR primer (reverse) - 100 nmol (Lyophilized)
Sequence:
TCCATTTCGCCGAAGCGCTG
info@gentaur.com 0.0 EUR
DNAnimal Ident Beef IPC (LR/HR) PCR kit - 96 reactions
info@gentaur.com 0.0 EUR
DirectPCR Lysis Reagent (Cell) - 100mL
info@gentaur.com 0.0 EUR
DirectPCR Lysis Reagent (Cell) - 50mL
info@gentaur.com 0.0 EUR
DirectPCR Lysis Reagent (Ear) - 50 ml
info@gentaur.com 0.0 EUR
DirectPCR Lysis Reagent (Mouse Ear) - 25 mL
info@gentaur.com 0.0 EUR
DirectPCR Lysis Reagent (Mouse Tail) - 100ml
info@gentaur.com 0.0 EUR
DirectPCR Lysis Reagent (Mouse Tail) - 50 mL
info@gentaur.com 0.0 EUR
Dog Bone Marrow cDNA - 30 reactions (30 PCR amplifications)
info@gentaur.com 0.0 EUR
Expin PCR SV mini - 200p
info@gentaur.com 0.0 EUR
Forget-Me-Not™ Universal Probe qPCR Master Mix - 1 mL (100 reactions)
info@gentaur.com 0.0 EUR
Forget-Me-Not™ Universal Probe qPCR Master Mix - 5x 1 mL (500 reactions)
info@gentaur.com 0.0 EUR
Geotrichum candidum One-Step real time PCR kit - 50 rnx
info@gentaur.com 0.0 EUR
Hepatitis D Virus (HDV) Real Time PCR Kit (Quantitative) - 100 reactions
info@gentaur.com 0.0 EUR
Human APOE genotypes (ε2/ε3/ε4) Real Time PCR Kit - 24 reactions
info@gentaur.com 0.0 EUR
Human Bone Marrow cDNA (primed with oligo dT primers) - 30 reactions (30 PCR amplifications)
info@gentaur.com 0.0 EUR
Human Bone Marrow cDNA (primed with random hexamer primers) - 30 reactions (30 PCR amplifications)
info@gentaur.com 0.0 EUR
Lactate dehydrogenase-elevating virus RT PCR & One Step qPCR, 100 rxn
info@gentaur.com 0.0 EUR
MDR Mycobacterium tuberculosis (Ethambutol) Real Time qPCR kit - 50 reactions
info@gentaur.com 0.0 EUR
Methylamp MS-qPCR Fast Kit - 200 Reactions
info@gentaur.com 0.0 EUR
Monkey (Cynomolgus) Lymph nodes cDNA - 30 reactions (30 PCR amplifications)
info@gentaur.com 0.0 EUR
Monkey (Cynomolgus) Prostate cDNA - 30 reactions (30 PCR amplifications)
info@gentaur.com 0.0 EUR
Nervous necrosis virus Real Time qPCR kit - 150 reactions
info@gentaur.com 0.0 EUR
Oncogenetics BRCA Panel Real-TM
info@gentaur.com 0.0 EUR
Optically clear sealing film for qPCR (Peelable) - 100 Films/Unit
info@gentaur.com 0.0 EUR
Optically clear sealing film for qPCR (Pierceable) - 100 Films/Unit
info@gentaur.com 0.0 EUR
Optically clear sealing film for qPCR (Strong bond) - 100 Films/Unit
info@gentaur.com 0.0 EUR
Red sea bream iridoviral disease Real Time qPCR kit - 150 reactions
info@gentaur.com 0.0 EUR
Renibacterium salmoninarum (Bacterial kidney disease, BKD) Real Time qPCR kit - 150 rnx.
info@gentaur.com 0.0 EUR
SARS-CoV-2 Real-Time PCR kit - 96 tests
info@gentaur.com 0.0 EUR
Spawner-isolated mortality virus Real time PCR kit - 150 reactions
info@gentaur.com 0.0 EUR
Spring viraemia of carp virus Real Time qPCR kit - 150 reactions
info@gentaur.com 0.0 EUR
Tick-borne Encephalitis Virus (TBEV) Real Time RT-PCR Kit - 50 rnx
info@gentaur.com 0.0 EUR
Tribo™ Porcine QPCR, 100 reactions
info@gentaur.com 0.0 EUR
Truelab® Quattro Real Time Quantitative micro PCR Analyzer - 1 unit
info@gentaur.com 0.0 EUR
Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 20 tests
info@gentaur.com 0.0 EUR
Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 25 tests
info@gentaur.com 0.0 EUR
Truenat® MTB Plus (Chip-based Real Time PCR Test for Mycobacterium tuberculosis) - 50 tests
info@gentaur.com 0.0 EUR
Trypanosoma evansi PCR primer (forward) - 100 nmol (Lyophilized)
Sequence:
GCGGGGTGTTTAAAGCAATA
info@gentaur.com 0.0 EUR
Trypanosoma evansi PCR primer (reverse) - 100 nmol (Lyophilized)
Sequence:
ATTAGTGCTGCGTGTGTTCG
info@gentaur.com 0.0 EUR
qPCR Lentivirus Titration kit - 100 reactions
info@gentaur.com 0.0 EUR