Se rendre au contenu

PGADT7-AD plasmid - 2 µg

https://www.gentaur.com.pl/web/image/product.template/10871/image_1920?unique=325b45d
(0 avis)

0,00 € 0.0 EUR 0,00 € Hors taxes

info@gentaur.com

    Cette combinaison n'existe pas.

    Conditions générales
    Garantie satisfait ou remboursé de 30 jours
    Expédition : 2-3 jours ouvrables

    Promoter: LEU2, ADH1, T7

    Replicator: 2 ori, ori

    Plasmid classification: yeast series, yeast two hybrid carrier

    Plasmid size: 7987bp

    Prokaryotic resistance: Amp

    Screening markers: LEU2

    Cloned strain: DH5 alpha

    Culture conditions: 37 centigrade, aerobic LB

    Expression host: yeast cells

    5'sequencing primers: T7:TAATACGACTCACTATAGGG

    3'sequencing primers: primers designed according to sequence

    Use: Yeast expression

     

    pGADT7-AD Description

    is a yeast expression vector that is designed to express a protein of interestfused to a GAL4 activation domain (AD; amino acids 768–881). Transcription of the GAL4 ADfusion is driven by the constitutively active ADH1 promoter (PADH1), and is terminated at theADH1 transcription termination signal (TADH1). The GAL4 AD fusion contains an N-terminalSV40 nuclear localization signal (SV40 NLS; 1) that targets the protein to the yeast nucleus,and a hemagglutinin epitope tag (HA Tag), located between the GAL4 AD and the proteinof interest, that allows the protein to be easily detected with HA-tag antibodies.