Promoter: LEU2, ADH1, T7
Replicator: 2 ori, ori
Plasmid classification: yeast series, yeast two hybrid carrier
Plasmid size: 7987bp
Prokaryotic resistance: Amp
Screening markers: LEU2
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: yeast cells
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: primers designed according to sequence
Use: Yeast expression
pGADT7-AD Description
pGADT7-AD is a yeast expression vector that is designed to express a protein of interestfused to a GAL4 activation domain (AD; amino acids 768–881). Transcription of the GAL4 ADfusion is driven by the constitutively active ADH1 promoter (PADH1), and is terminated at theADH1 transcription termination signal (TADH1). The GAL4 AD fusion contains an N-terminalSV40 nuclear localization signal (SV40 NLS; 1) that targets the protein to the yeast nucleus,and a hemagglutinin epitope tag (HA Tag), located between the GAL4 AD and the proteinof interest, that allows the protein to be easily detected with HA-tag antibodies.
