Overslaan naar inhoud
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
VP72-K Forward Primer (King) - 9x 250 nmol (Lyophilized)
Sequence (5' to 3'):
CTGCTCATGGTATCAATCTTATCGA
info@gentaur.com 0.0 EUR
VP72-K Probe (King), 5'FAM, 3'TAMRA - 1 tube of 250 pmol (Lyophilized)
Sequence (5' to 3'):
FAM-CCACGGGAGGAATACCAACCCAGTG-TAMRA
info@gentaur.com 0.0 EUR
VP72-K Reverse Primer (King) - 9x 250 nmol (Lyophilized)
Sequence (5' to 3'):
GATACCACAAGATCRGCCGT
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
WSE-1710 Submerge-Mini - 1 Set
Includes: Main unit, Power cord, Gel Tray (L) x2, Gel Tray (S) x4, Gel Casting Stand (L), Gel Casting Stand (S), S size comb (9well/5well) x2, L size comb (22well/12well) x2
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
WSE-5400-U Printgraph Classic
Includes: Main unit, Control, UV
info@gentaur.com 0.0 EUR
WSL-1565 Kronos HT (100-240V)
Standard version Includes: Main Unit, CO2 unit, Heater, 2x 24well plate
adapter, 600nm light filter, Laptop, Software, 1 year warranty
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR
info@gentaur.com 0.0 EUR