Skip to Content
  1. All products
  2. Cox-F Forward Primer - 2x 250 nmol (Lyophilized)
  3. All products
Pricelist: Price List Default - EUR Pricelist
Pricelist: Price List Default - EUR Pricelist
Cox-F Forward Primer - 2x 250 nmol (Lyophilized)

Cox-F Forward Primer - 2x 250 nmol (Lyophilized)

(0 review)

Sequence (5' to 3'):
GTCTTAAGGTGGGCTGGGTG

PCR PCR reagent
0.00 € 0.00 € (Tax excluded)

Add to cart
Buy now
Terms and Conditions
30-day money-back guarantee
Shipping: 2-3 Business Days
Contact Us

Sequence (5' to 3'):

GTCTTAAGGTGGGCTGGGTG